Rosalind Community Support

Home » Community Forum » Issues
Search
Search this community...
Share a Feedback

Community Forum

"Champions" Idea | Implemented
Sign in with Facebook Idea | Accepted
Rate upcoming features Question | Pending

Knowledge Base

Signin into
Rosalind Community.

Signin with

Your email address
UserRules Password
Login

Problem 4

Follow
Vote
0
Unfollow
May be I bad understand problem, but in condition of task no say about situation when start of new pattern may be in area of previous pattern. PS:Sorry for my english
from Vladimir · 5 years & 39 days ago · 0 followers · 2 comments

Problem 4

Follow
Vote
0
Unfollow
Hi guys! I have strange feeling about problem 4. It looks that problm is very easy and a lot of people succesfully solved it. But I have no luck. I tried to solve it by using differen methods: search, regexp, plain symbol counting. It keeps saying that answer is wrong. I've checked my answer by hand and it looks ok. Maybe I just don't see something but I can't understand what's wrong. Here is one of my failed attempts to solve it: http://pastebin.com/7PhwfE4n
from igor · 5 years & 39 days ago · 0 followers · 2 comments

grammatic error

Follow
Vote
0
Unfollow
country in profile edit list named "Украине", but must "Украина"
from Crabar · 5 years & 38 days ago · 0 followers · 2 comments

ugly code paste

Follow
Vote
0
Unfollow
I can't figure out how to paste my code as a comment without getting empty lines (containing only the number of the line). See the comments of Problem #21
from Petar Ivanov · 5 years & 35 days ago · 0 followers · 2 comments

Problem 49 - bugged

Follow
Vote
0
Unfollow
In problem 49 sample is incorrect - string "ATGGGTCCAGAGTTTTGTAATTT" is not maximal repeat (since "ATGGGTCCAGAGTTTTGTAATTTA" has 2 appearances), and "TATA" is maximal repeat. Jury solution seems to be bugged too.
from ilya.kornakov · 5 years & 32 days ago · 0 followers · 2 comments

not existing problem

Follow
Vote
0
Unfollow
There is a reference of some "Introduction of Graphs" problem in the problem statement of SSET.
from Petar Ivanov · 5 years & 32 days ago · 0 followers · 2 comments

obvious bug

Follow
Vote
0
Unfollow
dataset has '_sequence_' but output doesn't
from xinhui · 4 years & 357 days ago · 0 followers · 2 comments

SUBS will not accept my result

Follow
Vote
0
Unfollow
I have visually checked two attempts with all visually motifs id'd but am told they are wrong. Cannot see anything 'wrong'!
from Robert Giden · 4 years & 350 days ago · 0 followers · 2 comments

The first problem

Follow
Vote
0
Unfollow
I have computed succefully (with the given example) the first problem; but the site still tell me that my solution is wrong; either, there is a problem in the submission process, or instructions on how we shoulf format the result of our computation are insufficient !
from Patrick Augereau · 4 years & 347 days ago · 0 followers · 2 comments

Can't access my user account

Follow
Vote
0
Unfollow
To whom it may concern, I used to log in using my google account. My rosalind user is "DRL". I can't log in now which could be due to several reasons: - I moved to the UK - I changed my email account from dominik.laetsch@googlemail.com to dominik.laetsch@gmail.com It would be great if you could help me access my account. Best regards, dom
from · 4 years & 19 days ago · 0 followers · 1 answer & 2 comments
We've changed your email to dominik.laetsch@gmail.com, so now you can reset your password using http://rosalind.info/accounts/password/reset/ .
from Rosalind · 4 years & 17 days ago

Comments link on the problem page

Follow
Vote
0
Unfollow
Currently, the comments link is under "post a solution here" and is really hard to spot. How about adding a link to the problem header, similar to how it is done in the problem table?
from Sergei Lebedev · 5 years & 30 days ago · 1 followers · 1 comment
I am really really sure that my code is okay, I could answer the sample dataset with ease, and I checked mannually and it is right, but still, the problem says its wrong. Here is the link of my code (java): http://paste.ideaslabs.com/show/i4B4LW6Uj Whats wrong with the problem? :P Thanks!
from Lucas · 4 years & 356 days ago · 0 followers · 1 comment

Wrong links

Follow
Vote
0
Unfollow
In the biological introduction to the 'Counting subsets problem' link 'single-nucleotide polymorphism' and link to 'Independent Segregation of Chromosomes' problem seem to be broken.
from Aliaksei Danchanka · 4 years & 305 days ago · 1 followers · 1 comment

GLOB

Follow
Vote
1
Unfollow
For the sample dataset my program returns a global alignment score of 4 instead of 8. I thought that meant we need to double the alignment score (one half for each of the two input strings). However doubling it or not, my solutions are still rejected by the system. Does anyone know what's wrong?
from explorer.dsh · 4 years & 118 days ago · 0 followers · 1 comment

PRTM: not correct output

Follow
Vote
0
Unfollow
seems that from mass table we can calculate that for SKADYEK weight is equal to 839.40242 so 2-digits rounded its 839.4, not the defined 839.41
from Serhiy · 5 years & 18 days ago · 0 followers · 1 comment
Previous
Showing 16 - 30 of 113 Feedback
Next
Rosalind · Community Support for Rosalind · Powered by UserRules · Terms