Rosalind Community Support

Home » Community Forum » Questions
Search
Search this community...
Share a Feedback

Community Forum

"Champions" Idea | Implemented
Sign in with Facebook Idea | Accepted
Rate upcoming features Question | Pending

Knowledge Base

Signin into
Rosalind Community.

Signin with

Your email address
UserRules Password
Login
my profile shows I've only completed 4 problems, but I've completed 19. 4 were before I joined a class; 19 I completed in the class.
from Jean Costello · 48 days ago · 0 followers · no answers or comments
When I trted to login with my gmail , it just linked me to the page of rosalind I don t know what to do my gmail is: Parsa232300@gmail.com
from Parsa dehghan · 186 days ago · 0 followers · 1 comment

password was not accepted

Follow
Vote
0
Unfollow
my class is using this website as a source, so I enrolled for that class but now i couldn't get access to it. Also when i typed in my username they said "The user account associated with this e-mail address cannot reset the password". what should i do now?
from Yuhsuan · 222 days ago · 0 followers · no answers or comments
What is the point of requiring a description of a question?
from William Stier · 226 days ago · 0 followers · no answers or comments

Where can I find the textbook?

Follow
Vote
0
Unfollow
Thanks for your great site. I'm interested in doing the textbook track, but I can't find a link anywhere to the actual textbook. Can you provide an amazon link or even just the title somewhere?
from Robert Sim · 256 days ago · 0 followers · no answers or comments

online judge platform

Follow
Vote
1
Unfollow
Would we build rosalind.info as a real online judge platform? For example, https://leetcode.com/. we can submit our code to the platform, instead of download input data and submit the result data. Thanks.
from lijia · 274 days ago · 0 followers · no answers or comments

Student feedback

Follow
Vote
0
Unfollow
Is there an option to give feedback to my students from within my virtual classroom? I would like to click on their solution, and then be able to give the student some feedback on their solution. I am not aware that that is possible right now.
from Sandra Smit · 317 days ago · 0 followers · 2 comments

Question about ORF

Follow
Vote
0
Unfollow
I try to figure out the solution of question"Open Reading Frame" but i find out that there must be something wrong with the sample output because the length of the output doesn't match a reasonable range. moreover, this question doesn't have question area for guest to discuss.
from Yanru ZENG · 321 days ago · 0 followers · no answers or comments
I Am the student of bioinformatics and wana PhD In bioinformatics .... please if it possible then reply me
from Muhammad Yaqoob · 334 days ago · 0 followers · no answers or comments
Hello It appears that the question "Enumerating k-mers Lexicographically" is either grading us incorrectly or we have not understood the question correctly. Can you please verify the answers?
from Rob Edwards · 1 year & 8 days ago · 0 followers · no answers or comments

How do I change my username?

Follow
Vote
0
Unfollow
I set up my account with OpenID. I need to change my username for a class I'm in, but I can't figure out how to do that. Thanks!
from Jonathan · 1 year & 21 days ago · 0 followers · no answers or comments

Open Reading Frame Question

Follow
Vote
0
Unfollow
Given: The example. If you run this against a commercial version (at: http://www.bioinformatics.org/sms2/orf_find.html) you get this output: >ORF number 1 in reading frame 1 on the direct strand extends from base 25 to base 69. ATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTTTGGAATAA >Translation of ORF number 1 in reading frame 1 on the direct strand. MGMTPRLGLESLLE* >ORF number 2 in reading frame 1 on the direct strand extends from base 76 to base 96. ATGATCCGAGTAGCATCTCAG >Translation of ORF number 2 in reading frame 1 on the direct strand. MIRVASQ 1. Why is the second one found, given that in frame 1 there is no terminating codon? 2. If this is true, then is the answers supplied incorrect? Not sure what to do at this point.
from Joe Trubisz · 1 year & 74 days ago · 0 followers · no answers or comments

Question on ORF Finder

Follow
Vote
1
Unfollow
Using the example on Open Reading Frames, can anyone explain to me why the results differ if you take the example and run it against a commercial ORF Finder? I ran it at: http://www.bioinformatics.org/sms2/orf_find.html and got this for frame 1: >ORF number 1 in reading frame 1 on the direct strand extends from base 25 to base 69. ATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTTTGGAATAA >Translation of ORF number 1 in reading frame 1 on the direct strand. MGMTPRLGLESLLE* >ORF number 2 in reading frame 1 on the direct strand extends from base 76 to base 96. ATGATCCGAGTAGCATCTCAG >Translation of ORF number 2 in reading frame 1 on the direct strand. MIRVASQ I'm totally confused, given that second ORF in the above example does not have a terminating codon. Is this the way it's supposed to work? If it is, then the example answer is wrong. Or, the commercial version is wrong. Not sure what to do.
from Joe Trubisz · 1 year & 74 days ago · 0 followers · no answers or comments

Missing data for Overlap Graph

Follow
Vote
0
Unfollow
The explanation says: "For a collection of strings and a positive integer k...". Then you proceed to give a dataset but no k-value. It's obvious that k=3 in the example, but what are you supposed to use for the test dataset? ,
from Joe Trubisz · 1 year & 81 days ago · 0 followers · no answers or comments

password lost

Follow
Vote
0
Unfollow
Hi, I have been inactive with my lotrus28 account for a long time. But I've decided to restart using Rosalind. Sure I couldn't recall the password but i couldn't even remember the e-mail to recover it. All my current e-mails are not in your DB so it's quite likely I used some 10minute site to register. Could you please remind me the e-mail I used? Or could you even send me the recovery message to lotus28@mail.ru? Thanks a lot, Fedor Galkin
from Fedor · 1 year & 109 days ago · 0 followers · 2 comments
Previous
Showing 1 - 15 of 121 Feedback
Next
Rosalind · Community Support for Rosalind · Powered by UserRules · Terms