Rosalind Community Support

Home » Community Forum » Questions » What is wrong in ORF?
Search
Search this community...
Share a Feedback

Community Forum

"Champions" Idea | Implemented
Sign in with Facebook Idea | Accepted
Rate upcoming features Question | Pending

Knowledge Base

Signin into
Rosalind Community.

Signin with

Your email address
UserRules Password
Login

What is wrong in ORF?

Follow
Vote
2
Unfollow
I'm trying to solve the problem ORF (http://rosalind.info/problems/orf/). I understand from where the first three proteins are taken, but I do not understand from where takes the fourth protein (MTPRLGLESLLE) in sample output! As a result, my program does not pass the test :(

Tell me where my mistake, pls! My reasoning below:

AGCCAUGUAGCUAACUCAGGUUACAUGGGGAUGACCCCGCGACUUGGAUUAGAGUCUCUUUUGGAAUAAGCCUGAAUGAUCCGAGUAGCAUCUCAG
AGC = S
CAU = H
GUA = V
GCU = A
AAC = N
UCA = S
GGU = G
UAC = Y
>>> start
AUG = M
GGG = G
AUG = M
ACC = T
CCG = P
CGA = R
CUU = L
GGA = G
UUA = L
GAG = E
UCU = S
CUU = L
UUG = L
GAA = E
<<< stop
UAA = Stop
GCC = A
UGA = Stop
>>> start
AUG = M
AUC = I
CGA = R
GUA = V
GCA = A
UCU = S
CAG = Q
-------------
GCCAUGUAGCUAACUCAGGUUACAUGGGGAUGACCCCGCGACUUGGAUUAGAGUCUCUUUUGGAAUAAGCCUGAAUGAUCCGAGUAGCAUCUCAG
GCC = A
>>> start
AUG = M
<<< stop
UAG = Stop
CUA = L
ACU = T
CAG = Q
GUU = V
ACA = T
UGG = W
GGA = G
UGA = Stop
CCC = P
CGC = R
GAC = D
UUG = L
GAU = D
UAG = Stop
AGU = S
CUC = L
UUU = F
UGG = W
AAU = N
AAG = K
CCU = P
GAA = E
UGA = Stop
UCC = S
GAG = E
UAG = Stop
CAU = H
CUC = L
-------------
CCAUGUAGCUAACUCAGGUUACAUGGGGAUGACCCCGCGACUUGGAUUAGAGUCUCUUUUGGAAUAAGCCUGAAUGAUCCGAGUAGCAUCUCAG
CCA = P
UGU = C
AGC = S
UAA = Stop
CUC = L
AGG = R
UUA = L
CAU = H
GGG = G
GAU = D
GAC = D
CCC = P
GCG = A
ACU = T
UGG = W
AUU = I
AGA = R
GUC = V
UCU = S
UUU = F
GGA = G
AUA = I
AGC = S
CUG = L
AAU = N
GAU = D
CCG = P
AGU = S
AGC = S
AUC = I
UCA = S
-------------
CUGAGAUGCUACUCGGAUCAUUCAGGCUUAUUCCAAAAGAGACUCUAAUCCAAGUCGCGGGGUCAUCCCCAUGUAACCUGAGUUAGCUACAUGGCU
CUG = L
AGA = R
UGC = C
UAC = Y
UCG = S
GAU = D
CAU = H
UCA = S
GGC = G
UUA = L
UUC = F
CAA = Q
AAG = K
AGA = R
CUC = L
UAA = Stop
UCC = S
AAG = K
UCG = S
CGG = R
GGU = G
CAU = H
CCC = P
CAU = H
GUA = V
ACC = T
UGA = Stop
GUU = V
AGC = S
UAC = Y
>>> start
AUG = M
GCU = A
-------------
UGAGAUGCUACUCGGAUCAUUCAGGCUUAUUCCAAAAGAGACUCUAAUCCAAGUCGCGGGGUCAUCCCCAUGUAACCUGAGUUAGCUACAUGGCU
UGA = Stop
GAU = D
GCU = A
ACU = T
CGG = R
AUC = I
AUU = I
CAG = Q
GCU = A
UAU = Y
UCC = S
AAA = K
AGA = R
GAC = D
UCU = S
AAU = N
CCA = P
AGU = S
CGC = R
GGG = G
GUC = V
AUC = I
CCC = P
>>> start
AUG = M
<<< stop
UAA = Stop
CCU = P
GAG = E
UUA = L
GCU = A
ACA = T
UGG = W
-------------
GAGAUGCUACUCGGAUCAUUCAGGCUUAUUCCAAAAGAGACUCUAAUCCAAGUCGCGGGGUCAUCCCCAUGUAACCUGAGUUAGCUACAUGGCU
GAG = E
>>> start
AUG = M
CUA = L
CUC = L
GGA = G
UCA = S
UUC = F
AGG = R
CUU = L
AUU = I
CCA = P
AAA = K
GAG = E
ACU = T
CUA = L
AUC = I
CAA = Q
GUC = V
GCG = A
GGG = G
UCA = S
UCC = S
CCA = P
UGU = C
AAC = N
CUG = L
AGU = S
<<< stop
UAG = Stop
CUA = L
CAU = H
GGC = G
-------------
from Дмитрий Кинаш · 3 years & 218 days ago · · 1 comment
Issue has been resolved. MTPRLGLESLLE is the substring MGMTPRLGLESLLE. Likely scenario errors protein production when the protein began to be constructed not from the first, and the second marker start.
from anonymous · 3 years & 199 days ago · Flag as inappropriate
Good Comment
Write a comment... Comment

Similar Feedback

Translating RNA into Protein Problem
2 years & 346 days ago · Pending
Translating RNA into Protein Problem
2 years & 346 days ago · Pending
Translating RNA into Protein
2 years & 346 days ago · Pending
Translating RNA into Protein
2 years & 346 days ago · Pending
Problem code"mRNA" does Sample Dataset not match Sa...
4 years & 337 days ago · Answered

Followers 

Rosalind · Community Support for Rosalind · Powered by UserRules · Terms